Transcript Slide 1
Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Calibration System FAM Detection Sequence 5’ AGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ Calibration Sequence 5’ AGTATTCATCCACAATTTTAAAAGGGGGAAAAGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ VIC FAM HIV FAM HCV VIC VCA PET ou TAMRA Results Calibrator FIOCRUZ - PATENT Standart curve FIOCRUZ NAT Platform Bio-Manguinhos/IBMP •Extraction •HTP •LTP •PCR Setup •Detection Liquid Microarrays for Diagnosis Liquid Microarrays Liquid Microarrays Liquid Microarrays Reporter Fluorescence Green laser Bead Fluorescence Red laser Pilot project multi-test HCV Multitest – multitest typical result 14000 Internal Control Chagas Ag 1 12000 HBV Ag1 10000 HCV Ag1 8000 6000 HCV Ag2 HIV Ag1 HIV Ag2 4000 HTLV Ag1 2000 0 4b1 4b5 5b2 6b6 8b5 9b1 10b3 11b6 15b1 15b4 Pool 1 HTLV Ag2 HTLV Ag3 HTLV2 Ag1 Syphilis Ag1 Syphilis Ag2 HCV - Antigen 1 12993 14000 12184 12000 11076 11787 11184 7316 8000 7346 7195 4888 6000 11486 10552 9668 10000 Net MFI 12957 4550 3287 4000 2608 1521 2000 98 2515 1370 694 618 130 0 HCV - Antigen 2 11656 12000 10753 Net MFI 10000 8756 8725 8080 8032 7106 8000 6000 0 2346 687 3205 1715 1865 6360 5170 4743 4000 2000 10212 4280 2430 2789 1162 505 679 562 Syphilis - Antigen 1 7000 6240 6216 6000 5417 4877 5000 4922 3703 4000 3000 5294 4734 3691 3165 3252 3154 2586 2516 2473 2369 2017 2000 1943 1574 1549 1441 1119 1000 291 0 Syphilis - Antigen 2 9653 10000 9230 9000 7860 8000 7964 7235 6890 7008 7000 6201 6113 6000 5302 4933 4807 4806 5000 4000 3000 4216 3411 3310 3274 1642 2209 3311 3029 2512 2000 1000 0 197 HTLV - Antigen 1 18,000 16368 16193 16,000 13616 14,000 12069 12,000 10726 11224 12961 11119 10168 9356 9198 10,000 Net MFI 11589 14214 13189 12363 17025 8077 8,000 5778 6,000 3854 4,000 918 847 2,000 320 167 - HTLV - Antigen 2 25000 20268 19307 20000 17533 Net MFI 15205 13973 15000 11377 10150 13357 12772 9192 10000 5000 7783 7041 4474 6224 4630 3357 1848 249 0 13140 11939 11542 2679 166 Chagas - Antigen 1 25000 23424 21919 20516 19943 20192 19541 19977 19265 20000 18648 18316 17291 16077 15000 14600 11295 11685 10816 10731 10000 9009 8740 4883 8730 5477 5000 495 0 Different Trypanosoma cruzi antigen preparations Trypanosoma cruzi ORFeome • 23,083 “genes” (GenBank, Jul 2009) • Highly redundant, estimated to be ~12,000 distinct gene loci • Few gene families account for a large proportion of genes (6 families, 4967 “genes”, 21% of gene content) • The repetitive nature of the genome makes assembly difficult. As a consequence, the ORF definition is worse than for other organisms. • Related organisms, as Leishmania sp. and T. brucei, have about 8,000 genes, which is a good estimation for the lower limit of T. cruzi genes. Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ ORFeome (Wikipedia) Orfeome is the totality of open reading frames(ORF) from one organism. ORFs are the most important genetic elements in genomes as they code for proteins Organism Genome (ORFs) ORFeome Suitable Vector (all ORFs in a suitable vector) (Gateway) Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ Pre-processing • Intense bioinformatics analysis, using all ORFs from Kinetoplastida genome projects, to better define the region to be amplified. • Primers are 30mer in average, i.e., US$6/gene 1st step. PCR amplification 2nd step. PCR purification 3rd step. Gateway entry 2 PCRs per gene, US$3/gene Magnetic, US$1/gene BP reaction, US$5/gene 4th step. Bacterial transformation, Colony picking and Culture Agar plates, 4 clones/gene, US$0.25/gene 5th step. Plasmid purification 6th step. Plasmid verification Magnetic, US$1/gene PCR, US$ 0,1/gene Trypanosoma cruzi ORFeome ICC/FIOCRUZ Current state (v. 0.2) • 3,840 primer pairs designed and ordered. Completeness 40% • 1,920 genes amplified (~85% of them were positive). 20% • ~7,500 clones collected and certified by PCR. 20% Future prospects (6 months, v. 1.0) • 7,680 primer pairs designed and ordered. • Amplification of all analyzed genes. • All clones (~30,000) collected and certified by PCR. • All clones sequenced and certified ORFeome produced. Future prospects (12-18 months, v. 2.0) • Information from other T. cruzi strain will be added and used for covering more ORFs that were excluded or not present in CL Brener. Trypanosoma cruzi ORFeome Genome (ORFs) Organism Interactome Localizome Suitable Vector (Gateway) HT protein expression Ag-Ab screening Downstream Applications ORFeome (among many others) (all ORFs in a suitable vector) Antonio G.P.Ferreira Bio-Manguinhos-Fiocruz Bruna P.F.Fonseca, Bio-Manguinhos-Fiocruz Edimilson D.Silva, Bio-Manguinhos-Fiocruz Christiane F.S.Marques Bio-Manguinhos –Fiocruz Alexandre Costa IBMP Viviane Goes IBMP Cristiane Reinarch IBMP Cesar A.B. Duarte, ICC-Fiocruz Leonardo Foti ICC-Fiocruz Christian M.Probst ICC-Fiocruz Daniela Parada Pavoni ICC-Fiocruz Samuel Goldenberg, ICC-Fiocruz/IBMP Marco Aurelio Krieger ICC-Fiocruz/IBMP [email protected]