Transcript Slide 1

Seed transmission of Candidatus Liberibacter asiaticus in periwinkle and
dodder along with low bacterial titer and without transmission of lethal disease
L.-J.
1Dept.
1,
Zhou Y.-P.
2
Duan ,
D. W.
1
Gabriel
and T.
2
Gottwald
of Plant Pathology, UF, Gainesville, FL 32653 and 2USDA-ARS-USHRL, Fort Pierce, FL 34945
Abstract
Materials and Methods:
Canadidatus Liberibacter asiaticus (Las) is the most widely-distributed species among three
species of Liberibacter that are associated with citrus Huanglongbing (HLB), a lethal
disease of citrus worldwide. In addition to citrus, periwinkle (Catharanthus roseus) and
dodder (Cuscuta pentagona) are two experimental hosts in which the bacteria can multiply
well. Symptoms of HLB in inoculated-periwinkle were characterized by progressive vein
and leaf yellowing, resulting in death of most HLB-infected periwinkles within six month
after first appearance of symptoms. Dodder plants did not exhibit symptoms, even when
they contain high titers of the bacterium. Las was detected in 33.3% and 23.3% of seeds
tested from HLB-infected periwinkle and dodder without resorting to nested PCR. The PCR
amplicons were confirmed by sequence analysis. Germination rates of these Las-positive
seeds from both plant species were normal. Over 80% of the periwinkle plants germinated
from the infected seeds showed initial HLB symptoms of vein yellowing and leaf yellowing
only when they were stressed by nutrient deficiency. Surprisingly, the disease progressed
slowly, and did not cause plant death, and all symptomatic plants became asymptomatic
after the stress was removed. The Las population remained in very low titer; in most cases,
detected only by nested PCR or regular PCR by increasing the concentration of the bacterial
DNA. The periwinkles-infected with Las via seed transmission have been maintained for
over six months. These results suggest that although Las was seed transmitted, a second,
undescribed component of an HLB disease complex was not.
Periwinkle and dodder are two HLB experimental hosts used in this study , and the later was also
used as plant vector to transmit HLB pathogen(s) from sweet orange to periwinkle or from periwinkle
to periwinkle. All the transmission experiments were performed in the HLB-proofed green house in
United State Horticulture Research Laboratory (USHRL), USDA-ARS, Fort Pierce, FL. HLB
infected source plant used for dodder transmission was potted sweet orange (Citrus sinensis) tree
moved from citrus orchard and maintained in the green house with typical HLB symptom.
Maintenance of Las in periwinkle was conducted by periodic top-grafting to healthy periwinkle .
Fifty dodder plants generated from HLB-infected dodder seeds were maintained on healthy
periwinkle plant before sampling for PCR test. From 2007-2008, 168 of periwinkle plants were
generated periodically from HLB-infected periwinkle seeds, and the leave sample were collected for
detection of Las bacteria after nutrient deficiency stressed for two month.
One hundred twenty seeds from each treatment were divided into 30 tubes with 4 seeds in each
tube, total DNA was extracted according to the instruction of Wizard Genomic DNA Purification Kit
(Promega Corp., Madison, WI) after freezing in liquid nitrogen and grinding seeds with disposable
plastic pestle in 1.5mL tube. Total DNA in midribs of periwinkle leaves from different treatment were
extracted as described by Irey et al.(2006) .
Conventional PCR and nest PCR primers listed in table 1. PCR product were cloned into the TOPO
TA cloning vector pCR2.1 , and subjected for sequence analysis. Real-time PCR amplifications were
performed using Applied Biosystems 7500 Real-Time PCR System, data were analyzed using
Applied Biosystems 7500 system SDS software version1.2. CT value less than 34.0 was considered
as Las-positive.
Fig 1. conventional PCR/nest PCR detection of the Las bacterium in periwinkle seeds collected
from HLB-infected plants with primer OI1/OI2c for conventional PCR (A ) plus CGO3F/CGO5R
for nest PCR primers (B ). From left to right: 1kb DNA ladder; 1-30, 30 periwinkle seeds DNA sample; +,
positive control; -, negative control.
Introduction
Citrus Huanglongbin (HLB), a lethal disease of citrus, has been widespread in most
citrus producing countries including Asian, Africa, Arabian Peninsula, and most recently
in Brazil and Florida (Bové 2006). By January 2008, the HLB has been spread
throughout thirty of the citrus producing counties in Florida since its first report on
August 2005. HLB is associated with phloem-limited fastidious α-proteobacteria in the
genus Candidatus Liberibacter. Canadidatus Liberibacter asiaticus (Las) is the most
widely-distributed species among three species of Candidatus Liberibacter that are
associated with citrus HLB, and the only species detected in Florida to date.
Las can be transmitted via insect vector Asian citrus psyllid (Diaphorina citri), by
grafting or through dodder transmission (Bové 2006, Halbert, 2004, Zhou et al., 2007),
however there is little information on the seed transmission of HL. Determination if Las
bacterium is seed transmissible is crucial for HLB disease control. Periwinkle
(Catharanthus roseus) and dodder (Cuscuta campestris) are two experimental host plant
in which HLB bacteria can multiply as well as or even better than those in citrus. The
main objective of this research was to determine if Las bacterium can presence in the
periwinkle or dodder seeds, and if Las bacterium can translocate from seeds to seedlings
and cause HLB in periwinkle.
Table 1. Primer list for conventional PCR, nest PCR and real-time PCR
16S rDNA GCGCGTATGCAATACGAGCGGCA
Size of
Annealing
PCR
Temp
product
64°C
Jagoueix, et al., 1996
OI2C
16S rDNA GCCTCGCGACTTCGCAACCCAT
64°C
Jagoueix, et al., 1996
CGO3f
16S rDNA RGGGAAAGATTTTATTGGAG
53°C
CGO5r
16S rDNA GAAAATAYCATCTCTGATATCGT
53°C
HLBas
16S rDNA TCGAGCGCGTATGCAATACG
HLBr
16S rDNA GCGTTATCCCGTAGAAAAAGGTAG
Prime
name
Target
gene
OI1
Sequence (5'-3')
1160bp
Reference
Zhou, et al., 2007
798bp
Zhou, et al., 2007
Li, W. et al, 2005
58°C
76bp
Li, W. et al, 2005
PROBE
HLBp
56-FAM/AGACGGGTGAGTAACGCG/3BHQ-1
Li, W. et al, 2005
Table 2: PCR test for the presence of Las bacterium in HLB-infected periwinkle and dodder
DNA sample
Periwinkle
Dodder
Conclusion
Ratio of positive sample
Total No.
Conventional PCR
Nest PCR
qPCR
Seeds
30(120 seeds)
33.3%
56.7%
53.3%
Plant tissue
168
0
7.10%
0
Seeds
30(120 seeds)
23.3%
40%
36.70%
Plant tissue
50
0
3.72%
0
Results
Fig 1. Symptom of HLB-infected periwinkle. A: graft transmitted periwinkle with
yellowing and small leave; B: graft transmitted periwinkle with rapid systemic
movement of yellowing symptom; C: 4 month after dodder transmission showing leave
yellowing and wilt tip resulting in death of plant; D. Dodder transmitted periwinkle
survival over one year with complex symptom-half of the plant remains sick and the
other half has become asymptomatic.
Fig. 2. Periwinkle and dodder seed transmission. A, B: HLB-infected and non-infected
periwinkle without morphological difference; C, D: HLB-infected and non-infected
periwinkle without morphological difference ; E, F: vein yellowing symptom on seed
transmitted periwinkle after nutrient deficiency
From 2007-2008, all of the 18 periwinkle plants connected to HLB infected sweet orange start to
showing symptom within three month after connection through dodder, all of the 40 graft-inoculated
periwinkle plant start to showing symptom within one month after grafting. Symptoms of HLB in all
inoculated-periwinkle were characterized by progressive vein and leaf yellowing, some of them
accompany with small leave and/or wilt (Fig1), resulting in death of most HLB-infected periwinkles
within six month after first appearance of symptoms (Fig 1 C), except for one of dodder transmitted
periwinkle which is one side recovery from diseased symptom with tested nest PCR negative, while
the other side still showing typical symptom and tested strong positive by conventional PCR. This
periwinkle plant has been survive for more than one and half years. Dodder plants did not exhibit
symptoms, even when they contain high titers of the bacterium.
Las was detected from 33.3% -56.7% of HLB-infected periwinkle seeds by conventional PCR and
nest PCR, and 23.3%-40% from infected dodder seeds by conventional PCR and nest PCR (Table 2),
the conventional PCR product were confirmed by sequence analysis, however no significant
morphological differences could be observed between HLB-infected and non-infected periwinkle and
dodder seeds (Fig 2, A-D), and germination rates of these Las-positive seeds from both plant species
were normal. Over 80% of the periwinkle plants germinated from the infected seeds showed initial
HLB symptoms of vein yellowing and leaf yellowing only when they were stressed by nutrient
deficiency(Fig2 E-F), among which 7.1% of periwinkle and 3.72% of dodder detected were HLB nest
PCR positive, all symptomatic plants became asymptomatic after the stress was removed. The disease
progressed slowly, and did not cause plant death, the periwinkles-infected with Las via seed
transmission have been maintained for over one year.
1. The Las population was high in HLB-infected periwinkle and dodder seeds, but remained very low
titer in seed transmitted periwinkle and dodder; in most cases, detected only by nested PCR.
2. The vein yellowing symptom on seed transmitted periwinkle plant only shown up when they were
stressed by nutrient deficiency, and back to normal after nutrient recovery.
3. Most of dodder transmitted or graft transmitted HLB infected periwinkle plant died within 6 month
after inoculation, but seed transmitted periwinkle plant has been survival for over one year.
4. The reason for the only one periwinkle with half symptomatic and half asymptomatic is due to plant
nature resistance or complex interaction among different endophyte bacteria still unknown.
5. These results suggest that although Las was seed transmitted, a second, undescribed component of an
HLB disease complex was involves or not still worth to know.
References Cited
1. Bové, J. M. 2006. Huanglongbing: A destructive, newly emerging, century-old disease of citrus. J.
Plant Pathol. 88: 7-37.
2. Capoor, S. P., Rao, D. G. and Viswanath, S. M. 1967. Diaphorina citri Kuway., a vector of the
Huanglongbing disease of citrus in India. Indian J. Agr. Sci. 37: 572-576.
3. Halbert, S.E., Manjunath, K.L., 2004. Asian citrus psyllid (Sternorrhycha: Psyllidae) and greening
disease of citrus: A literature review and assessment of risk in Florida. Fla. Entomol. 87:330-353
4. Jagoueix, S., Bové, J. M. and Garnier, M. 1996. PCR detection of the two ‘Candidatus’ Liberobacter
species associated with greening disease of citrus. Mol. and Cell. Probes 10: 43-50.
5. Li, W.B., Hartung, J. S., and Levy, L. 2006. Quantitative real-time PCR for detection and
identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol.
Methods 66: 104-115.
6. Zhou L. J., Gabriel D. W., Duan Y. P., Halbert S. E., and Dixon W. N., 2007. First report of dodder
transmission of Huanglongbing from naturally infected Murraya paniculata to citrus. Plant Disease,
91:227.